Review



px330 gfp backbone  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc px330 gfp backbone
    Px330 Gfp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+gfp+backbone/pX330-GFP-SFPQ+(Plasmid+%2397084)/bio_rxiv__64898__2025__12__16__693263-195-15-30
    Average 93 stars, based on 6 article reviews
    px330 gfp backbone - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Long-read proteogenomic atlas of human neuronal differentiation reveals isoform diversity informing neurodevelopmental risk mechanisms
    Article Snippet: .. The CLYBL safe harbor sgRNA (ATGTTGGAAGGATGAGGAAA, R. Tian et al., 2019) was cloned into the pX330-GFP backbone , . iPSCs were dissociated into single cells and electroporated with both pCLYBL-TO-hNGN2-BSD-mApple (Addgene #124229, Tian et al., 2019 ) and pX330-GFP-CLYBLsgRNA. ..



    Similar Products

    px330 gfp backbone  (Addgene inc)
    93
    Addgene inc px330 gfp backbone
    Px330 Gfp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px330+gfp+backbone/pX330-GFP-SFPQ+(Plasmid+%2397084)/bio_rxiv__64898__2025__12__16__693263-195-15-30
    Average 93 stars, based on 1 article reviews
    px330 gfp backbone - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results